Automating with brefito
Back to the Main Curation Tutorial Page
In this part of the tutorial, we will automate running the curation cycle on many genomes at once using brefito.
What's happening?
brefito is a helper script and set of snakemake workflows that make it easier to run these steps on many samples in parallel. Once you set up a control file telling it what to do, it generates and runs all of the commands that you need!
Installing brefito¶
Follow the directions for installing brefito.
Since brefito is actively updated (and we might even fix bugs while doing this tutorial), consider using the editable install instructions. This will make it quicker to update your code to the newest version.
Setting up the data file¶
To use brefito you will specify a set of samples and the references files and read files that are associated with each sample. This is accomplished by creating a data.csv file in the main directory in which you will perform the analysis. For everything in this part of the tutorial we will be describing what you put inside this main directory.
First, read the brefito overview to learn a bit about the main command and the format of the data.csv file.
A simple template for this file would look like this:
sample,type,setting
SAMPLENAME1,illumina-PE,READPATH1
SAMPLENAME2,illumina-PE,READPATH2
...
SAMPLENAMEX,illumina-PE,READPATHX
*,reference,REFERENCEPATH
The data.csv file is in a comma-separated values format. You can edit it in either a text editor or in a spreadsheet program. Be careful to export as a CSV with UTF-8 encoding if you use a spreadsheet program.
For example, here's how we would set up a run of the 75K-generation A and B clones from LTEE population A-1. You can run an analysis on many more than two samples at once using what you will learn here, but at least this example will start to show you how using brefito can simplify your life.
For purposes of this tutorial, we are going to put all of the input read files we need in an input subdirectory and tell brefito to use these files. If your reads are accessible online (for example, in the SRA or stored on a fileserver that can be accessed publicly or privately through lftp) there are other ways to set this up described in the documentation that will save you the step of manually having to copy the files to this location.
Since all of our samples are LTEE genomes and the E. coli REL606 reference file is available online, we will give brefito a URL to download that from. (The URL is complex because it is for a specific version from the LTEE-Ecoli repository.)
One trick for paired-end Illumina reads is that putting the special wildcard string {1|2} inside of the READPATH makes it match both files with either a 1 or a 2 there, so you can easily specify both FASTQ files for paired-end reads in one line. It's also possible to put two lines, one with the name of each file, and as long as they have a 1 and corresponding 2 in the filenames and match otherwise, brefito should be able to figure out that they belong together.
So your data.csv file might end up looking something like this:
sample,type,setting
A-1_75K_clone_A,illumina-PE,input/75K-1A_LTC-0000001_S.R{1|2}.fastq.gz
A-1_75K_clone_B,illumina-PE,input/75K-1B_LTC-0000002_S.R{1|2}.fastq.gz
*,reference,https://raw.githubusercontent.com/barricklab/LTEE/7da91974eafac0c5a8f903ae57275795d4395af2/reference/REL606.gbk
To get this to work, you MUST download/copy/move these four files into a new input directory that you create within your main directory:
75K-1A_LTC-0000001_S.R1.fastq.gz
75K-1A_LTC-0000001_S.R2.fastq.gz
75K-1B_LTC-0000002_S.R1.fastq.gz
75K-1B_LTC-0000002_S.R2.fastq.gz
If you had single-end reads, you would specify just illumina or illumina-SE in place of illumina-PE. If you want to combine analyzing FASTQ files from multiple instrument runs (perhaps you didn't get enough coverage the first time), just add extra lines for that sample. You can also specify nanopore reads and use these as input.
Tip
brefito takes care of running the right programs to trim different types of reads and setting breseq options to be appropriate. Usually, its default settings should work, but if you want more control, see the brefito workflow descriptions for how you can pass setting to specific programs that are run as part of a pipeline.
You could test whether your data.csv is set up correctly by running the brefito command that downloads and copies the input files to its particular locations (Remember to activate your brefito conda environment to run this command!)
brefito download-data --resources connections=4
Note
The --resources connections=4 part is optional. It tells brefito how many downloads it is allowed to initiate simultaneously. By default, it is 1. Don't set this too high if you are on a shared machine! Something in the range 4-8 can often speed up the downloads by quite a bit, but at some point there are diminishing returns because you only have so much bandwidth in your connection to the internet. If you are following the previous steps, it actually doesn't help to have multiple downloads, because there is just the one reference file that will be downloaded and the read files are already on your machine.
If everything worked, you should now have reference and illumina-reads subdirectories.
If you get an error, most likely there is something wrong with your paths! Check that the FASTQ files have the right names and are in the input directory within the main directory where you are running brefito and have your data.csv file.
Running breseq on all of the samples¶
Now, running breseq on all samples is as simple as running this command:
brefito predict-mutations-breseq --config BRESEQ_OPTIONS="-l 80"
BRESEQ_OPTIONS gets sent to every breseq command, so this limits the nominal coverage read-depth to 80x. (We have a lot of reads for these samples, so it will take a long time to run and a lot of disk space if you don't do this without any real gain in detecting mutations.) If you wanted to also use polymorphism mode, you could add -p inside of the double quotes.
Caution
You should not pass the -j option for controlling how many threads breseq uses in this way. The number of threads to use is specified by the Snakemake workflow in a different way.
The final output will be in breseq-references (breseq run against the files in the references directory).
Note
Notice that a new directory called illumina-reads-trimmed is also created because this workflow first trims the reads. If you ever want to just trim the reads, there are different brefito sub-workflows you can use called trim-illumina-reads and trim-nanopore-reads. You can see all of the workflows by running brefito --help.
brefito divides up the breseq output into data, gd, and html subdirectories by sample, so that it is easy to grab just the pieces you need. One thing that is nice about the gd output directory is that instead of having to rename the output.gd from each breseq run to SAMPLE.gd when you are curating them, brefito already does this for you.
If something goes wrong, check the logs in the log subdirectory. This is where the output you would normally see going to the terminal is piped (because it would get confusing to have it jumbled together from many breseq runs happening simultaneously).
Note
In the future, we plan to add a say of changing breseq options on a per-sample basis. For now, you should set up different brefito analysis folders for using different options.
Additional analysis examples¶
Some common analysis steps can also be automated by brefito!
For example, this
brefito compare-mutations-breseq
breseq-references/compare_1.html with the output. If you had sets of samples with different reference sequences, you would have more output files with names ending 2, 3, 4, etc., for each set of samples that shared the same reference sequences.
Note
If you know you want this final output, you can actually run this command FIRST, and brefito will also run all of the required breseq , read trimming, downloading, etc., steps it needs to get to this output!
This command will generate tiled and summary coverage plots for all samples.
brefito coverage-plots-breseq
breseq-references/cov.
Curating the GenomeDiff files¶
Copy the breseq-references/gd directory to a new genome-diffs.
cp -r breseq-references/gd genome-diffs
Edit these GenomeDiff files as described in other parts of this tutorial to curate their mutation lists.
When you are ready to check the mutation lists you annotated in your curated GenomeDiff files, it's always good to first quickly check their syntax with this command.
brefito validate-genome-diff-gdtools
genome-diffs-validate.
You can open each individual text file, or view them all at once by typing this command:
cat genome-diffs-validate/*
Then, you can generate the mutated genomes with this command.
brefito mutate-genomes-gdtools
mutants with the mutated reference genomes.
Then, re-run breseq against these mutant genomes using this command.
brefito predict-mutations-breseq-mutants --config BRESEQ_OPTIONS="-l 80"
Note
predict-mutations-breseq and some other workflows that use reference sequences in the references directory by default can be switched over to using other directories of reference files with this predict-mutations-breseq-* syntax. Here * is mutants, but you could create your own directory called whatever and substitute it here.
Other brefito Functions¶
BLAST searches against the reference files¶
Repeat or near-repeat sequences in your reference genome can make interpreting certain parts of the breseq output difficult (such as JC evidence items) when a sequence matches multiple places in the genome.
brefito search-blast CACCAAAACGTGCCGAGATGATCCTGTAACCATCATCAGTTGTGAAGTAGTGATTCACGACTTCAAGGCGCTTTTCAAAAGGGTATTTTGGCTTTGACATATTAGGGGCTATTCCATTTCATCGTCCAACAAAATGGGTGCAGTAC A-1_75K_clone_A
This creates a long HTML BLAST output file output file ending in *.html and a short tabular BLAST output file ending in *.tsv inside of the blast-references directory. The output of the short tabular file is also output directly so you can look at that immediately.
Instead of providing a DNA sequence at the command line, you can replace that argument with the path to a FASTA file:
brefito search-blast input.fasta A-1_75K_clone_A
The contents of the file input.fasta should be in FASTA format. So, it should look something like this:
>input
CACCAAAACGTGCCGAGATGATCCTGTAACCATCATCAGTTGTGAAGTAGTGATTCACGA
CTTCAAGGCGCTTTTCAAAAGGGTATTTTGGCTTTGACATATTAGGGGCTATTCCATTTC
ATCGTCCAACAAAATGGGTGCAGTAC
You can also use the workflow search-blast-mutants to BLAST against one of the mutant genomes you generated versus the default of using the references.
Warning
If you leave off the last sample argument (A-1_75K_clone_A in the examples above) brefito will perform individual BLAST runs against ALL of your reference sequences. Usually this will be redundant if they all have the same references! If you do want to BLAST against multiple references, but only specific ones, you can continue the command line by adding additional sample names (e.g., A-1_75K_clone_B)
Next: Common curation cases